View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3148_low_9 (Length: 245)
Name: NF3148_low_9
Description: NF3148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3148_low_9 |
 | |
|
| [»] scaffold0036 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0036 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 10089 - 10248
Alignment:
| Q |
1 |
attaggattgtaattaaaagtacctacctcagataaagaatctcaggtattcaattaagggttataaagatgaaatgctatccaagattgattgaaaata |
100 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10089 |
attagtattgtaattaaaagtacctacgtcagataaagaatctcaggtattcaattaagggttataaagatgaaatgctatccaagattgattgaaaata |
10188 |
T |
|
| Q |
101 |
aatcctaatcacttgagatcctaaatcctaattgcaatctcaacttagccaagaataatt |
160 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10189 |
aatcctaatcacttcagatccaaaatcctaattgcaatctcaacttagccaagaataatt |
10248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 189 - 227
Target Start/End: Original strand, 10277 - 10315
Alignment:
| Q |
189 |
cctgaacgaatttataactgtttctggtggccgacggcg |
227 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10277 |
cctgaacgactttataactgtttctggtggccgacggcg |
10315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University