View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3149_low_16 (Length: 233)
Name: NF3149_low_16
Description: NF3149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3149_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 15 - 217
Target Start/End: Complemental strand, 35914210 - 35914008
Alignment:
| Q |
15 |
acaattgacaaatcattgcatttaacttggcatttgaatgcacttcaatgtctttctttatgtacgcaagtcaatgcctactttccttatttgtagaaag |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35914210 |
acaattgacaaatcattgcatttaacttggcatttgaatgcacttcaatgtctttctttatgtacgcaagtcaatgcctgctttccttatttgtagaaag |
35914111 |
T |
|
| Q |
115 |
agttgtcgcatcattgaagtattggagaaaccctttggtggagaagatcaccgatctagatgattgaccaaagtgtgttgacttcttttctgatcataga |
214 |
Q |
| |
|
||||||| ||| |||||||||| |||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35914110 |
agttgtcacattattgaagtatcggagaaaccctttggtggagaagatcactgatccagatgattgaccaaagtgtgttgacttcttttctgattataga |
35914011 |
T |
|
| Q |
215 |
att |
217 |
Q |
| |
|
||| |
|
|
| T |
35914010 |
att |
35914008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University