View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3150_high_12 (Length: 404)
Name: NF3150_high_12
Description: NF3150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3150_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 84 - 377
Target Start/End: Original strand, 5713101 - 5713393
Alignment:
| Q |
84 |
atgcttggagaggctttgtatccgctagtagatcagctggaacatgattcagcagctaaggttactggcatgcttctggagatggaccagcctgaagcat |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
5713101 |
atgcttggagaggctttgtatccgctagtagatcagctggaacatgattcagcagctaaggttactggcatgcttctggagatggaccagcctgaagtat |
5713200 |
T |
|
| Q |
184 |
tgcatttgattgagtcaccagatgctctcaaggctaaagttgctgaagccatggaggtgttgagaaatgttggtcaacagcaaggaaacagcccggcgga |
283 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5713201 |
tgcatttgatcgagtcaccagatgctctcaaggctaaagttgctgaagccatggaggtgttgagaaatgttagtcaacagcaaggaaacagcccggcgga |
5713300 |
T |
|
| Q |
284 |
tcaactagcctcactctctctcaatgactcttagatttctattaatccgtctacatgaattccacaccatcatttctataccccccacaccccg |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5713301 |
tcaactagcctcactctctctcaatgactcttaga-ttctattaatccgtctacatgaattccacaccatcatttctataccccccaaaccccg |
5713393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 19 - 83
Target Start/End: Original strand, 5712915 - 5712979
Alignment:
| Q |
19 |
cacctatgcccattcatgctttggctacagcacttgcgaatgctccccctgaacagcagaggact |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5712915 |
cacctatgcccattcatgctttggctacagcacttgcgaatgctccccctgaacagcagaggact |
5712979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 3e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 141 - 304
Target Start/End: Complemental strand, 47003814 - 47003651
Alignment:
| Q |
141 |
aaggttactggcatgcttctggagatggaccagcctgaagcattgcatttgattgagtcaccagatgctctcaaggctaaagttgctgaagccatggagg |
240 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||| | || ||| |||||||||||||||| ||||||||| ||||||||||||| ||| |||| | |
|
|
| T |
47003814 |
aaggttactggtatgcttttggagatggaccagcctgaggtgttacatctgattgagtcaccagaggctctcaagactaaagttgctgaggccgtggatg |
47003715 |
T |
|
| Q |
241 |
tgttgagaaatgttggtcaacagcaaggaaacagcccggcggatcaactagcctcactctctct |
304 |
Q |
| |
|
||||||||||||||| || |||||| |||||||| | |||||||| || || |||||||| |
|
|
| T |
47003714 |
tgttgagaaatgttgcacagcagcaatcgaacagcccaactgatcaacttgcttctctctctct |
47003651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 26 - 83
Target Start/End: Complemental strand, 47004037 - 47003980
Alignment:
| Q |
26 |
gcccattcatgctttggctacagcacttgcgaatgctccccctgaacagcagaggact |
83 |
Q |
| |
|
|||||| || ||| |||||||||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
47004037 |
gcccatgcaggctctggctacagcccttgcaaatgctcctcctgaacagcagaggact |
47003980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 144 - 205
Target Start/End: Original strand, 33422420 - 33422481
Alignment:
| Q |
144 |
gttactggcatgcttctggagatggaccagcctgaagcattgcatttgattgagtcaccaga |
205 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||| |||| ||| | ||||||||||| |
|
|
| T |
33422420 |
gttactggtatgcttctggagatggaccagactgaagttctgcacttgctcgagtcaccaga |
33422481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University