View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3150_high_17 (Length: 295)
Name: NF3150_high_17
Description: NF3150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3150_high_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 19 - 172
Target Start/End: Complemental strand, 1824895 - 1824741
Alignment:
| Q |
19 |
gaagtaaaaaatgttaaattgacaaaaacaaatcattttgggcactcaaaatttcataactattttctgtcccataattgggacaaattgcttagaacaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1824895 |
gaagtaaaaaatgttaaattgacaaaaacaaatcattttgggcactcaaaatttcataactattttctgtcccataattgggacaaattgcttagaacaa |
1824796 |
T |
|
| Q |
119 |
ctgaggtgaaaac-aaataattaaagtagtgattccccataaaaacatcattttg |
172 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1824795 |
ctgagatgaaaacaaaataattaaagtagtgattccccataagaacatcattttg |
1824741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 203 - 280
Target Start/End: Complemental strand, 1824712 - 1824635
Alignment:
| Q |
203 |
tgtttgtacgggcaacaccaccaccttgaacatttgattttaccattttttaatcatgtaattgattgtagttggaac |
280 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
1824712 |
tgtttgtacgggcaacatcaccaccttaaacatttgattttaccattttttaaccatgtaattgatagtagttggaac |
1824635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University