View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3150_high_18 (Length: 286)
Name: NF3150_high_18
Description: NF3150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3150_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 9 - 272
Target Start/End: Original strand, 50177378 - 50177638
Alignment:
| Q |
9 |
gacatcatcaaactcgtcttgggtttcagcttcttcatctgccgatgagtcgggtgaacttgcatctagagcatcattgagatatgaaatgaagtcatcg |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50177378 |
gacatcctcaaactcgtcttgggtttcagcttcttcatctgccgatgagtcgggtgaacttgcatctagagcatcattgagatatgaaatgaagtcatcg |
50177477 |
T |
 |
| Q |
109 |
ctgccagaagaatgtgcgggagaatctgtaactacactcatgtattatacctgtcatccaacaaaaccacaaatgaggaagcaatgattgggagatatag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50177478 |
ctgccagaagaatgtgcgggagaatctgtaactacactcatg---tatacctgtcatccaacaaaaccacaaatgaggaagcaatgattgggagatatag |
50177574 |
T |
 |
| Q |
209 |
aaagtttcacagcacaataatagcggttactcaatcgggtttctacaatgatgattgcaaattg |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50177575 |
aaagtttcacagcacaataatagcggttactcaatcgggtttctacaatgatgattgcaaattg |
50177638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University