View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3150_high_27 (Length: 244)
Name: NF3150_high_27
Description: NF3150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3150_high_27 |
 |  |
|
| [»] scaffold0110 (2 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0110 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 244
Target Start/End: Original strand, 31778 - 32004
Alignment:
| Q |
18 |
gatggagcaaatgtgtttggataccatgcttggtcattgcttgataactttgaatggagattagggtacacatcaaggtttggtattgtctatgttgact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31778 |
gatggagcaaatgtgtttggataccatgcttggtcattgcttgataactttgaatggagattagggtacacatcaaggtttggtattgtctatgttgact |
31877 |
T |
 |
| Q |
118 |
tcaaaactctcaagagaacccctaagatgtctgcatattggttcaagcagctacttaccaaaaagaagtaaattgttgagctaaaaatatggttcttaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31878 |
tcaaaactctcaagagaacccctaagatgtctgcatattggttcaagcagctacttaccaaaaagaagtaaattgttgagctaaaaatatggttcttaag |
31977 |
T |
 |
| Q |
218 |
tttctaattgtggtagtgaataatgtt |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31978 |
tttctaattgtggtagtgaataatgtt |
32004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110; HSP #2
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 23982 - 24165
Alignment:
| Q |
18 |
gatggagcaaatgtgtttggataccatgcttggtcattgcttgataactttgaatggagattagggtacacatcaaggtttggtattgtctatgttgact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23982 |
gatggagcaaatgtgtttggataccatgcttggtcattgcttgataactttgaatggagattagggtacacatcaaggtttggtattgtctatgttgact |
24081 |
T |
 |
| Q |
118 |
tcaaaactctcaagagaacccctaagatgtctgcatattggttcaagcagctacttaccaaaaagaagtaaattgttgagctaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24082 |
tcaaaactctcaagagaacccctaagatgtctgcatattggttcaagcagctacttaccaaaaagaagtaaattgttgagctaa |
24165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 100
Target Start/End: Original strand, 29425655 - 29425707
Alignment:
| Q |
48 |
tggtcattgcttgataactttgaatggagattagggtacacatcaaggtttgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||| ||||| || |||||||| |
|
|
| T |
29425655 |
tggtcattgcttgataactttgaatggggtttaggctacacttcgaggtttgg |
29425707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University