View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3150_high_30 (Length: 236)
Name: NF3150_high_30
Description: NF3150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3150_high_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 17 - 175
Target Start/End: Complemental strand, 3937497 - 3937328
Alignment:
| Q |
17 |
gaacatgacagagctagtacacatcccagatgcaaggaatagagttgattcagcaccctccaatgcactgattttagatt------------nnnnnnnn |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3937497 |
gaacatgacagagctagtacacatcccagatgcaaggaatagagttgattcagcaccctccaatgcactgattttagattaaaaaaaaaaaaaaagattt |
3937398 |
T |
 |
| Q |
105 |
ntaacatgaatatatttataatatataaaatcaccttggtgaaaatataatccaattataaatttgtgcta |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3937397 |
gtaacatgaatatatttataatatataaaatcacattggtgaaaatataat-caattataaatttgtgcta |
3937328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 191 - 220
Target Start/End: Complemental strand, 3937309 - 3937280
Alignment:
| Q |
191 |
ggaaaatcatatttgggctaacctatttac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3937309 |
ggaaaatcatatttgggctaacctatttac |
3937280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University