View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3150_low_18 (Length: 332)
Name: NF3150_low_18
Description: NF3150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3150_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 21 - 316
Target Start/End: Original strand, 40076773 - 40077068
Alignment:
| Q |
21 |
aactcaaatcctttaacttcaccacaaacaccgactttgctggtcctgatttgttacacgacccttcagacaaaaccttctatgacgatccacaaacatg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40076773 |
aactcaaatcctttaacttcaccacaaacaccgactttgctggtcctgattttttacacgacccttcagacaaaaccttctatgacgatccacaaacatg |
40076872 |
T |
 |
| Q |
121 |
ttacaccatggacaaaccagtgaaaaattgggacgagaagcgtaaagaatggctacttcaccatccttcattcgtggtcggagcaagcgaaaagatactt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40076873 |
ttacaccatggacaaaccagtgaaaaattgggacgagaagcgtaaagaatggctacttcaccatccttcattcgtggtcggagcaagcgaaaagatactt |
40076972 |
T |
 |
| Q |
221 |
gttataaccggttcacaacctacaaagtgtgacaacccgattggcgaccaccttttactgcggttctttaaaaacaaggttgattattgtcgtata |
316 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40076973 |
gttataacgggttcacaacctacaaagtgtgacaacccgattggcgaccaccttttactgcggttctttaaaaacaaggttgattattgtcgtata |
40077068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University