View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3150_low_38 (Length: 232)
Name: NF3150_low_38
Description: NF3150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3150_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 12159747 - 12159532
Alignment:
| Q |
1 |
ctatggctttccatctttgctagctcacacatactcaattcaagttgtgtagatgacttatcccacacgcaagaaacacttttcccccctcacattaagt |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12159747 |
ctatggctttccatctttgctaactcacacatactcaattcaagttgtgtagatgacttatcccacacgcaagaaacactttttccccctcacattaagt |
12159648 |
T |
 |
| Q |
101 |
caaacatgaaccacctcaatctcataacataccacgttattagttaatatctaaagccacaaatacacacatacccggaaacttttgcaatcacaagcaa |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12159647 |
caaacatgaaccacctcaatttcataacataccacgttattagttaatatctaaagccacaaatacacacatacccggaaacttttgcaatcacaagcaa |
12159548 |
T |
 |
| Q |
201 |
ccaatccataaacaca |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
12159547 |
ccaatccataaacaca |
12159532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University