View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3150_low_43 (Length: 219)
Name: NF3150_low_43
Description: NF3150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3150_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 35 - 145
Target Start/End: Complemental strand, 7234840 - 7234729
Alignment:
| Q |
35 |
taggggtgtaattaagaaagttaggggtgggagaagaagggaggagaagaggaagtaatagaaggggttgaagggttaatttata-agagaaaaaggtga |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7234840 |
taggggtgtaattaagaaagttaggggtgggagaagaagggaggagaagaggaagtaatagaaggggttgaagggttaatttatagagagaaaaaggtga |
7234741 |
T |
 |
| Q |
134 |
gtaagggagcgt |
145 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7234740 |
gtaagggagcgt |
7234729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University