View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151B-Insertion-11 (Length: 457)
Name: NF3151B-Insertion-11
Description: NF3151B
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151B-Insertion-11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 376; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 8 - 426
Target Start/End: Complemental strand, 21937328 - 21936909
Alignment:
| Q |
8 |
attacaacactagaaa-taagagatcaagtaaatttgcaacgaagtcagaacattagcgatgaagatttgaagatagtgtaccaactgtgatttaacaat |
106 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
21937328 |
attacaacactagaaaataagagatcaagtaaatttgcaacgaagtcagaacattagcgatcaacatttgaagatagtgtaccaactgtgatttaacaac |
21937229 |
T |
|
| Q |
107 |
cgcgatggatcgcgtcgttgcacgcgcaccacgggagggtatggaaaatatgtaaaaatgaaagaggaaaagctagacggagttactcactgtttgtggc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21937228 |
cgcgatggatcgcgtcgttgcacgcgcaccacgggagggtatggaaaatacgtaaaaatgaaagaggaaaagctagacggagttactcactgtttgtggc |
21937129 |
T |
|
| Q |
207 |
ggccgaaaaccaactccggcggcgttttccggcggtggattgagttcagtgcgacggcaacttgtttttctgagatggaaggaagatggcaaaacggcag |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21937128 |
ggccgaaaaccaactccggcggcgttttccggcggtggattgagttcagtgcgacggcatcttgtttttctgagatggaaggaagatggcaaaacggcag |
21937029 |
T |
|
| Q |
307 |
tggacgatggacgatgggcctctccaaaatgaaactcgactgggcttggggattagcttaagcttgagtccacgtggatgttacacatcaacacttaacg |
406 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21937028 |
tggacgatggacgatttgcctctccaaaatgaaagtcgactgggctttgggattagcttaagcttgagtccacgtggatgttacacatcaacacttaacg |
21936929 |
T |
|
| Q |
407 |
gccatgtcacacggttaaaa |
426 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
21936928 |
gccatgtcacacggttaaaa |
21936909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 173 - 238
Target Start/End: Original strand, 27243876 - 27243941
Alignment:
| Q |
173 |
gaaaagctagacggagttactcactgtttgtggcggccgaaaaccaactccggcggcgttttccgg |
238 |
Q |
| |
|
||||| || ||||||||| || |||||||| ||||||||| || ||||||||||||||||||||| |
|
|
| T |
27243876 |
gaaaacctggacggagtttctaactgtttgcggcggccgacgacgaactccggcggcgttttccgg |
27243941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University