View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151B-Insertion-18 (Length: 258)
Name: NF3151B-Insertion-18
Description: NF3151B
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151B-Insertion-18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 8 - 155
Target Start/End: Original strand, 10178664 - 10178811
Alignment:
| Q |
8 |
ggtttcgggtttggcgcagaacaagatgattgagttagcaaaaaagtattttcatatcttgccttataaagacattggtgcatggtctgcaatgatcact |
107 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10178664 |
ggtttcgggtttggcgcaaaacaaaatgattgagttagcaaaaaagtattttcatatcttgccttataaagacattgctgcatggtctgcaatgatcact |
10178763 |
T |
|
| Q |
108 |
gcatatgtggatgaggagcaggtggatgaagtccgcgacctttttatt |
155 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
10178764 |
gcatatgtggatgaggagcaggtggataaagttcgcgacctttttatt |
10178811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 154 - 258
Target Start/End: Original strand, 10181497 - 10181601
Alignment:
| Q |
154 |
ttggaatcatgtaggtttcaatcgccctgaacgagcatgattggctcaggattggcacagcaggatcatattctacaatttttgctgatactttttggtg |
253 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||||| ||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
10181497 |
ttggaatcatgtaggtttcaatcaccctgaacgagcatcattggctcaagattggcaccacaggatcctattctaccatttttgctgatactttttggtg |
10181596 |
T |
|
| Q |
254 |
ggctt |
258 |
Q |
| |
|
||||| |
|
|
| T |
10181597 |
ggctt |
10181601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University