View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151B-Insertion-22 (Length: 196)
Name: NF3151B-Insertion-22
Description: NF3151B
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151B-Insertion-22 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-103; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 8 - 196
Target Start/End: Original strand, 47212606 - 47212794
Alignment:
| Q |
8 |
gtatttttgtgtcagcatttgcatggtcatggggtccacttgcttggcttattccaagtgagatatttccactagagactcgttctgcaggacaaagtgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47212606 |
gtatttttgtgtcagcatttgcatggtcatggggtccacttgcttggcttattccaagtgagatatttccactagagactcgttctgcaggacaaagtgt |
47212705 |
T |
|
| Q |
108 |
aacagtttgtgtcaacttcctcttcactgctgtcattgcacaagctttcctttcaatgctttgctatttcaagtttggtatcttctttt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47212706 |
aacagtttgtgtcaacttcctcttcactgctgtcattgcacaagctttcctttcaatgctttgctatttcaagtttggtatcttctttt |
47212794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 25 - 107
Target Start/End: Original strand, 47185995 - 47186077
Alignment:
| Q |
25 |
tttgcatggtcatggggtccacttgcttggcttattccaagtgagatatttccactagagactcgttctgcaggacaaagtgt |
107 |
Q |
| |
|
||||||||||||||||||||||||| |||| | ||||| ||||||| |||||| | |||||| | || || ||||||||||| |
|
|
| T |
47185995 |
tttgcatggtcatggggtccacttggttggttaattcctagtgagacatttcctttggagactagatcagctggacaaagtgt |
47186077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 25 - 107
Target Start/End: Original strand, 47198534 - 47198616
Alignment:
| Q |
25 |
tttgcatggtcatggggtccacttgcttggcttattccaagtgagatatttccactagagactcgttctgcaggacaaagtgt |
107 |
Q |
| |
|
||||||||||||||||||||||||| |||| | ||||| ||||||| |||||| | |||||| | || || ||||||||||| |
|
|
| T |
47198534 |
tttgcatggtcatggggtccacttggttggttaattcctagtgagacatttcctttggagactagatcagctggacaaagtgt |
47198616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 59; Significance: 3e-25; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 16 - 194
Target Start/End: Complemental strand, 748677 - 748499
Alignment:
| Q |
16 |
gtgtcagcatttgcatggtcatggggtccacttgcttggcttattccaagtgagatatttccactagagactcgttctgcaggacaaagtgtaacagttt |
115 |
Q |
| |
|
||||| || ||||| ||||| |||||||| || | |||||||||||||||||||| ||||||||| |||||||| || || ||||||||||| ||||||| |
|
|
| T |
748677 |
gtgtctgcctttgcttggtcttggggtcctctcggttggcttattccaagtgagacatttccactcgagactcgatcagctggacaaagtgtcacagttt |
748578 |
T |
|
| Q |
116 |
gtgtcaacttcctcttcactgctgtcattgcacaagctttcctttcaatgctttgctatttcaagtttggtatcttctt |
194 |
Q |
| |
|
|||||||| | | ||||| ||||||||| || ||||| || || ||| | ||| | ||||||||||| |||||||| |
|
|
| T |
748577 |
gtgtcaacatgttgttcacctttgtcattgctcaggcttttctatctatgttatgccacttcaagtttggaatcttctt |
748499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 30 - 105
Target Start/End: Complemental strand, 41414096 - 41414021
Alignment:
| Q |
30 |
atggtcatggggtccacttgcttggcttattccaagtgagatatttccactagagactcgttctgcaggacaaagt |
105 |
Q |
| |
|
||||||||||||||| |||| |||| ||||||||||||||||||||| |||| | ||||| ||||| |||||| |
|
|
| T |
41414096 |
atggtcatggggtcctcttggttggacaattccaagtgagatatttccattagaaatccgttcagcagggcaaagt |
41414021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 24 - 109
Target Start/End: Original strand, 36202701 - 36202786
Alignment:
| Q |
24 |
atttgcatggtcatggggtccacttgcttggcttattccaagtgagatatttccactagagactcgttctgcaggacaaagtgtaa |
109 |
Q |
| |
|
|||||| |||||||||||||| |||| |||| | |||| |||||||| || ||| | |||| ||||||||||| |||||||||| |
|
|
| T |
36202701 |
atttgcttggtcatggggtcctcttggttggttggttcctagtgagattttcccattggagattcgttctgcagctcaaagtgtaa |
36202786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University