View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151B-Insertion-25 (Length: 150)
Name: NF3151B-Insertion-25
Description: NF3151B
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151B-Insertion-25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 5e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 5e-48
Query Start/End: Original strand, 8 - 112
Target Start/End: Original strand, 2991505 - 2991609
Alignment:
| Q |
8 |
gatttgtgcaatagcaccatcaaagaagatgatagaagtatcgtagagaccttcaagagcgtaatctcttgctaacttgacatgatcttgtaaacctgct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2991505 |
gatttgtgcaatagcaccatcaaagaagatgatagaagtatcatagagaccctcaagagcgtaatctcttgctaacttgacatgatcttgtaaacctgct |
2991604 |
T |
 |
| Q |
108 |
aatga |
112 |
Q |
| |
|
||||| |
|
|
| T |
2991605 |
aatga |
2991609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University