View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151_1D_high_18 (Length: 220)
Name: NF3151_1D_high_18
Description: NF3151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151_1D_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 7 - 126
Target Start/End: Complemental strand, 14541616 - 14541495
Alignment:
| Q |
7 |
tttggtgttatacgtatattat--cacatattgtgtcagaaaagatttgcttccatcttcttcgagtattggtcaaggtactgttattgtccccgacccc |
104 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14541616 |
tttggtgttatacgtatattatatcacatattgtgtcagaaaatatttgcttccatcttcttcgagtattggtcaaggtactgttattgtccccgacccc |
14541517 |
T |
 |
| Q |
105 |
gactgctacattgaactaattg |
126 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
14541516 |
gactgctacattgaactaattg |
14541495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University