View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151_1D_high_20 (Length: 210)
Name: NF3151_1D_high_20
Description: NF3151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151_1D_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 38005054 - 38004857
Alignment:
| Q |
1 |
ggcatgatggattgagtatttgtggggatcgatgattctaattcaagttaattgacaattgaattttattttagtgggagtcaatataattggttttcaa |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38005054 |
ggcatgatggattgagtatttttggggatcgatgattctaattcaagttaattgacaattgaattttattttagtgggagtcaatataattggttttcaa |
38004955 |
T |
|
| Q |
101 |
agtttcattgtggtgaaatttcacttttggttccaacnnnnnnnttcagcagatattgtaattgagaataattatggatgttaaatttacttttgttc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38004954 |
agtttcattgtggtgaaatttcacttttggttccaacaaaaaaattcagcagatattgtaattgagaatagttatggatgttaaatttacttttgttc |
38004857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University