View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151_1D_high_6 (Length: 445)
Name: NF3151_1D_high_6
Description: NF3151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151_1D_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 50 - 422
Target Start/End: Original strand, 41263020 - 41263393
Alignment:
| Q |
50 |
gaaatgggatacaattaacatgttgctgaatgatagagacaaaggagaaattctaaaattgcatttcccc--ccttttatgcaggtttgccagatcatat |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41263020 |
gaaatgggatacaattaacatgttgctgaatgatagagacaaaggagaaattctaaaattgcatttccccccccttttatgcaggtttgccagatcatat |
41263119 |
T |
|
| Q |
148 |
ttgcaacgacaccacaatgttgttgtagtgcttatggaggtgaaggaacgacatggtcttggaagaattaagaatatcaactatgcaaattggagaatta |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41263120 |
ttgcaacgacaccacaatgttgttgtagtgcttatggaggtgaaggaacgacatggtcttggaagaattaagactatcaactatgcaaattggagaatta |
41263219 |
T |
|
| Q |
248 |
ggacaatcaaataggttactttacttgcaatttacctatannnnnnnnctgcttttatatttttgtagcattttagttctcaaaaatcttttgtcaaact |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41263220 |
ggacaatcaaataggttactttacttgcaatttacctata-tttttttctgcttttatatttttgtagcattttagttctcaaaaatcttttgtcaaact |
41263318 |
T |
|
| Q |
348 |
ttacactctttggaggagtcgaggaagccacattagaaggacaaagtttcttcattagtgtgtaagcgtttgaag |
422 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41263319 |
ttacactctttggaggagttgaggaagccacattagaaggacaaagtttcttcattagtgtgtaagcgtttgaag |
41263393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 153 - 200
Target Start/End: Complemental strand, 50510102 - 50510054
Alignment:
| Q |
153 |
acgacaccacaatgttgttgtagtgcttatgg-aggtgaaggaacgaca |
200 |
Q |
| |
|
|||||| ||||||| |||||| |||||||||| |||||||||||||||| |
|
|
| T |
50510102 |
acgacatcacaatgatgttgtggtgcttatggaaggtgaaggaacgaca |
50510054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University