View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151_1D_low_12 (Length: 334)
Name: NF3151_1D_low_12
Description: NF3151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151_1D_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 280 - 315
Target Start/End: Complemental strand, 52402863 - 52402828
Alignment:
| Q |
280 |
agtagttagtatggttttcaattcatattacttgtt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
52402863 |
agtagttagtatggttttcaattcatattacttgtt |
52402828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University