View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151_1D_low_14 (Length: 315)
Name: NF3151_1D_low_14
Description: NF3151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151_1D_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 82 - 245
Target Start/End: Complemental strand, 10171331 - 10171168
Alignment:
| Q |
82 |
ttggttaatttcgtcaagaatcaacatcattgctacgatgaatgcatagtcaacattgggatgcaccctaaccgtgagattatctttgccaaacgcagca |
181 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10171331 |
ttggttaatttcgtcaagaatcaacatcactgctacgatgaatgcatagtcaacattgggatgcaccctaaccgtgagattatctttgccaaacgcagca |
10171232 |
T |
|
| Q |
182 |
ctttgaacagtctgcttcttatgcatctacaatcaaataaaattgcatttgcaagattagaatt |
245 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10171231 |
ctttgaacagtctccttcttatgcatctacaatcaaataaaattgcatttgcaagattaaaatt |
10171168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 273 - 308
Target Start/End: Complemental strand, 10171135 - 10171100
Alignment:
| Q |
273 |
tatcttacattttaacggggttaaattttcacgtaa |
308 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10171135 |
tatcttacatttttacggggttaaattttcacgtaa |
10171100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 67
Target Start/End: Complemental strand, 4705044 - 4705008
Alignment:
| Q |
31 |
ttagttagggttatgtttgaaatatctagtaacttga |
67 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
4705044 |
ttagttagggttatgtttgaaacatctagtaatttga |
4705008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University