View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151_1D_low_19 (Length: 295)
Name: NF3151_1D_low_19
Description: NF3151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151_1D_low_19 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 12 - 295
Target Start/End: Complemental strand, 12009203 - 12008920
Alignment:
| Q |
12 |
atgaacaaaatgcgcgtaacaatagcaataaccaacacatgagtcagcataatgcagcttggacaagacctcctatacgacgatataaaggcaaagttga |
111 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12009203 |
atgaacaaaatgcgcgtatcaatagcaataaccaacacacgagtcagcataatgcagcttggacaagacctcctatacgacgatataaaggcaaagttga |
12009104 |
T |
 |
| Q |
112 |
cgcctctttttcgagatcgcgcggtaaagtgggtatttgcgtgtgtatacaggatgataggccaatttgtactagcaaaaactgagtagatttctcctat |
211 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| | ||||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
12009103 |
cgcctctttttcgagatcgcgcagtaaagtgggtattggtgtgtgtatagaggatgataggccaatttgtgctagcaaaaaccgagtagatttctcctat |
12009004 |
T |
 |
| Q |
212 |
tcttggtgccgatattggagaatcattaggactcttccatgctatgaagtaggtaagagatttacaacttaataatgtggtatt |
295 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12009003 |
tcttgatatcgatattggagaatcattaggactctttcatgctatgaagtaggtaagagatttagaacttaataatgtggtatt |
12008920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University