View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151_1D_low_24 (Length: 273)
Name: NF3151_1D_low_24
Description: NF3151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151_1D_low_24 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 268; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 6 - 273
Target Start/End: Original strand, 52796253 - 52796520
Alignment:
| Q |
6 |
aggtttgtcaccaccacacgagtcctttacaatactgtctcgtagacatggtcctatcatgaccctttggctaggttccatgtgcaccgtagttgtctct |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52796253 |
aggtttgtcaccaccacacgagtcctttacaatactgtctcgtagacatggtcctatcatgaccctttggctaggttccatgtgcaccgtagttgtctct |
52796352 |
T |
 |
| Q |
106 |
tcctgtgaagcagcccgtgacatgttcaaaaacaacgatgcggctcttgcaggaaggaaggtttatgaggccatgaaagggaatcataaccatggcagtg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52796353 |
tcctgtgaagcagcccgtgacatgttcaaaaacaacgatgcggctcttgcaggaaggaaggtttatgaggccatgaaagggaatcataaccatggcagtg |
52796452 |
T |
 |
| Q |
206 |
aaggttcactcataacttctcaatatgatgcgcactggcgcatgcttaggcgcttgagcaccactgag |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52796453 |
aaggttcactcataacttctcaatatgatgcgcactggcgcatgcttaggcgcttgagcaccactgag |
52796520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University