View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151_1D_low_26 (Length: 264)
Name: NF3151_1D_low_26
Description: NF3151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151_1D_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 18 - 141
Target Start/End: Complemental strand, 2816891 - 2816768
Alignment:
| Q |
18 |
tcaaatatacccttcatggttcgtaactctggaactgtttagaagttaacttccaactcctgatcactcaagtttgggagttacgaccagatacaccttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
2816891 |
tcaaatatacccttcatggttcgtaactctggaactgtttagaagttaacttccaactcctgatcgctcaagtttgggagttacgaccagatacgccttg |
2816792 |
T |
|
| Q |
118 |
aacataatagaacacgcatgttct |
141 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
2816791 |
aacataatagaacatgcatgttct |
2816768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 140 - 250
Target Start/End: Complemental strand, 3822346 - 3822236
Alignment:
| Q |
140 |
ctgttacactacgttgtttctccaagttgaatgattagtaggactttgagttgagtgaccttcacttttgtcagcaatgaggtagtagctatagtacatt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3822346 |
ctgttacactacgttgtttctccaagttgaatgattagtaggactttgagttgagtgaccttcacttttgtcagcaatgaggtagtagctatagtacatt |
3822247 |
T |
|
| Q |
240 |
ttttgtttcat |
250 |
Q |
| |
|
||||||||||| |
|
|
| T |
3822246 |
ttttgtttcat |
3822236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University