View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151_1D_low_31 (Length: 251)
Name: NF3151_1D_low_31
Description: NF3151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151_1D_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 20 - 221
Target Start/End: Complemental strand, 3675016 - 3674807
Alignment:
| Q |
20 |
cacattccagagataacaacgtgtacatcagcttctgctccaaataacgggtcggtatagtgattctttttaatagttaactagtaattaaaatgaagcc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3675016 |
cacattccagagataacaacgtgtacatcagcatctgctccaaataacgggtcggtatagtgattctttttaatagttaagtagtaattaaaatgaagcc |
3674917 |
T |
 |
| Q |
120 |
tagttgattaaaaatctaaataactatgttctgaaacgaatcaggtttagtactgagtaacagta--------actactccaagaagaagaatggaagta |
211 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3674916 |
tagttgattacagatctaaataactatgttctgaaacgaatcaggtttagtactgagtaacagtaatactagtactactccaagaagaagaatggaagta |
3674817 |
T |
 |
| Q |
212 |
gtggttgaaa |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
3674816 |
gtggttgaaa |
3674807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University