View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151_1D_low_42 (Length: 223)
Name: NF3151_1D_low_42
Description: NF3151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151_1D_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 45552745 - 45552947
Alignment:
| Q |
20 |
agattggttgttcggaaaacttatacaatagtttatagtttatggtataggaaagtttggattggtttgtttaagtttcaacaacagccttacaacaaat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45552745 |
agattggttgttcggaaaacttatacaatagtttatagtttatggtataggaaagtttggattggtttgtttacgtttcaacaacagccttacaacaaat |
45552844 |
T |
|
| Q |
120 |
gatgttttcggtatttttaagctgcaagatccggacaacttttctccccaacgagggtatataacaggtaccaaatcttaaaagtttaggactccttcat |
219 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
45552845 |
gatgtttttggtatttttaagctgcaagatcccaacaacttttctccccaatgagggtatataacaggtaccaaatcttaaaagattaagactccttcat |
45552944 |
T |
|
| Q |
220 |
tga |
222 |
Q |
| |
|
||| |
|
|
| T |
45552945 |
tga |
45552947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University