View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3151_1D_low_44 (Length: 220)

Name: NF3151_1D_low_44
Description: NF3151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3151_1D_low_44
NF3151_1D_low_44
[»] chr8 (1 HSPs)
chr8 (7-126)||(14541495-14541616)


Alignment Details
Target: chr8 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 7 - 126
Target Start/End: Complemental strand, 14541616 - 14541495
Alignment:
7 tttggtgttatacgtatattat--cacatattgtgtcagaaaagatttgcttccatcttcttcgagtattggtcaaggtactgttattgtccccgacccc 104  Q
    ||||||||||||||||||||||  ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14541616 tttggtgttatacgtatattatatcacatattgtgtcagaaaatatttgcttccatcttcttcgagtattggtcaaggtactgttattgtccccgacccc 14541517  T
105 gactgctacattgaactaattg 126  Q
    ||||||||||||||||||||||    
14541516 gactgctacattgaactaattg 14541495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University