View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151_1D_low_45 (Length: 220)
Name: NF3151_1D_low_45
Description: NF3151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151_1D_low_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 214
Target Start/End: Complemental strand, 2429852 - 2429651
Alignment:
| Q |
13 |
attctatgttggaggcatcttcaatgacatgcaagataaccaatgacatgcagtaagctaaagcaggattttagcaattaagtaccaaataaggatatca |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2429852 |
attccatgttggaggcatcttcaatgacatgcaagataaccaatgacatgcagtaagctaaagcaggattttagcaattaagtaccaaataaggatatca |
2429753 |
T |
|
| Q |
113 |
tatgtatcattaaacatttccttaagttctccactaataaagtgaaaaacaatgataatgttattattgtcacatcaaataagataaactctttgttaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2429752 |
tatgtatcattaaacatttccttaagttctccactaataaagtgaaaaacaatgataatgttattattgtcacatcaaataagataaactctttgttaaa |
2429653 |
T |
|
| Q |
213 |
tt |
214 |
Q |
| |
|
|| |
|
|
| T |
2429652 |
tt |
2429651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University