View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151_1D_low_51 (Length: 212)
Name: NF3151_1D_low_51
Description: NF3151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151_1D_low_51 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 9e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 76 - 206
Target Start/End: Complemental strand, 45763414 - 45763284
Alignment:
| Q |
76 |
acaactaaatcaagttctctagaaggtatcattagataaggactacaattattggaattaactaaatcaaaagtttattgtttttccttattgtatgtga |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45763414 |
acaactaaatcaagttctctagaaggtatcattagataaggactacaattattggaattaactaaatcaaaagtttattgtttttccttattgtgtgtga |
45763315 |
T |
|
| Q |
176 |
catttactaaatgttaatgaatggagatatc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45763314 |
catttactaaatgttaatgaatggagatatc |
45763284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 5166868 - 5166955
Alignment:
| Q |
1 |
aaaaactatgaatcttttccttttgaaattgaagctaatagaaatcactcctcaataccaaccttcacaatgagcacaactaaatcaa |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5166868 |
aaaaactatgaatcttttccttttgaaattgaagctaatagaaatcactcctcaataccaaccttcacaatgagcacaacaaaatcaa |
5166955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University