View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151_1D_low_56 (Length: 207)
Name: NF3151_1D_low_56
Description: NF3151_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151_1D_low_56 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 13909588 - 13909373
Alignment:
| Q |
1 |
aaagctgaatatggaagaaagaggtctaaat----------gagaacaacttagagctttggtttcaaattgttcgaacattgaaagatggactatccaa |
90 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||| |||||||||||||| ||||||| |||||||||||||| | ||||| |
|
|
| T |
13909588 |
aaagctgaatatggaaaaaagaggtctaaatcaaagaatgtgagaacaatttagtgctttggtttcaaactgttcgaccattgaaagatggattgtccaa |
13909489 |
T |
|
| Q |
91 |
acaaaattgagctcatccaattatgcaaatgtggttcaaaccgacgattctagtaatgaaagataaaaacttgtgctttgtctagcaagtgaacaaatgc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13909488 |
acaaaattgagctcatccaattatgcaaatgtggttcaaaccgacgattctagtaatgaaagataaaaacttatgctttgtctagcaagtgaacaaatgc |
13909389 |
T |
|
| Q |
191 |
atggattcttcacttt |
206 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
13909388 |
atggattcttcacttt |
13909373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University