View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151_2D_low_51 (Length: 329)
Name: NF3151_2D_low_51
Description: NF3151_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151_2D_low_51 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 13 - 313
Target Start/End: Complemental strand, 12009203 - 12008903
Alignment:
| Q |
13 |
atgaacaaaatgcgcgtaacaatagcaataaccaacacatgagtcagcataatgcagcttggacaagacctcctatacgacgatataaaggcaaagttga |
112 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12009203 |
atgaacaaaatgcgcgtatcaatagcaataaccaacacacgagtcagcataatgcagcttggacaagacctcctatacgacgatataaaggcaaagttga |
12009104 |
T |
|
| Q |
113 |
cgcctctttttcgagatcgcgcggtaaagtgggtatttgcgtgtgtatacaggatgataggccaatttgtactagcaaaaactgagtagatttctcctat |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| | ||||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
12009103 |
cgcctctttttcgagatcgcgcagtaaagtgggtattggtgtgtgtatagaggatgataggccaatttgtgctagcaaaaaccgagtagatttctcctat |
12009004 |
T |
|
| Q |
213 |
tcttggtgccgatattggagaatcattaggactcttccatgctatgaagtaggtaagagatttacaacttaataatgtggtattcgagttagattccaaa |
312 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12009003 |
tcttgatatcgatattggagaatcattaggactctttcatgctatgaagtaggtaagagatttagaacttaataatgtggtattcgagttagattccaaa |
12008904 |
T |
|
| Q |
313 |
c |
313 |
Q |
| |
|
| |
|
|
| T |
12008903 |
c |
12008903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University