View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151_2D_low_76 (Length: 250)
Name: NF3151_2D_low_76
Description: NF3151_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151_2D_low_76 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 34 - 235
Target Start/End: Original strand, 3674807 - 3675016
Alignment:
| Q |
34 |
tttcaaccactacttccattcttcttcttggagtagt--------tactgttactcagtactaaacctgattcgtttcagaacatagttatttagatttt |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3674807 |
tttcaaccactacttccattcttcttcttggagtagtactagtattactgttactcagtactaaacctgattcgtttcagaacatagttatttagatctg |
3674906 |
T |
 |
| Q |
126 |
taatcaactaggcttcattttaattactagttaactattaaaaagaatcactataccgacccgttatttggagcagaagctgatgtacacgttgttatct |
225 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3674907 |
taatcaactaggcttcattttaattactacttaactattaaaaagaatcactataccgacccgttatttggagcagatgctgatgtacacgttgttatct |
3675006 |
T |
 |
| Q |
226 |
ctggaatgtg |
235 |
Q |
| |
|
|||||||||| |
|
|
| T |
3675007 |
ctggaatgtg |
3675016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University