View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151_2D_low_87 (Length: 228)
Name: NF3151_2D_low_87
Description: NF3151_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151_2D_low_87 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 10 - 228
Target Start/End: Original strand, 16842533 - 16842751
Alignment:
| Q |
10 |
attattcttcgataattggtactcttgtgagtgtttgagagggctgggaaagtttatgagttgccgtgttttcttaaaggtttgttttatctgtatattt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16842533 |
attattcttcgataattggtactcttgtgagtgtttgagagggctgggaaagtttatgagttgccgtgttttcttaaaggtttgttttatctgtatattt |
16842632 |
T |
|
| Q |
110 |
tggttaatcggagttgttgttccactgtggttatggcttatgtgaagaataagttggtagatgatttgttcttgtaaagaggcaggtttgctcgaggatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16842633 |
tggttaatcggagttgttgttccactgtggttatggcttatgtgaagaataagttggtagatgatttgttcttgtaaagaggcaggtttgctcgaggatg |
16842732 |
T |
|
| Q |
210 |
ctgttggaatatataacca |
228 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
16842733 |
ctgttggaatatataacca |
16842751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 10 - 174
Target Start/End: Original strand, 24209372 - 24209538
Alignment:
| Q |
10 |
attattcttcgataattggtactcttgtgagtgttt--gagagggctgggaaagtttatgagttgccgtgttttcttaaaggtttgttttatctgtatat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||||| |||||||| |||||| |
|
|
| T |
24209372 |
attattcttcgataattggtactcttgtgagtgtttatgagagggctgggaaagtttatgagttgccgcgtttgcttaaaggttcgttttatcggtatat |
24209471 |
T |
|
| Q |
108 |
tttggttaatcggagttgttgttccactgtggttatggcttatgtgaagaataagttggtagatgat |
174 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24209472 |
tttggttaatcagagctgttgttccactgtggttatggcttatgtgaagaataagttggtggatgat |
24209538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 171 - 228
Target Start/End: Original strand, 24209606 - 24209663
Alignment:
| Q |
171 |
tgatttgttcttgtaaagaggcaggtttgctcgaggatgctgttggaatatataacca |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24209606 |
tgatttgttcttgtaaagaggcaggtttgcttgaggatgctgttggaatatataacca |
24209663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University