View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151_2D_low_91 (Length: 220)
Name: NF3151_2D_low_91
Description: NF3151_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151_2D_low_91 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 34583996 - 34584114
Alignment:
| Q |
1 |
caacgttttatatgttaaatgatgaaatcaatttaggtttattctcatatattaattttgcaaaggcattgtcttatattcgtttttcattgatgtcctc |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34583996 |
caacgttttatatgttaaatga---aatcaatttaggtttattctcatatattaattttgcaaaggcattgtcttatattcgtttttcattgatctcct- |
34584091 |
T |
 |
| Q |
101 |
ttttgttagcatttatgtttttg |
123 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
34584092 |
ttttgttagcatatatgtttttg |
34584114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 116 - 192
Target Start/End: Complemental strand, 34583941 - 34583865
Alignment:
| Q |
116 |
tgtttttgcataacttgactcaaagttacaccattttggacacttgattgggattttttatatctctggtctagggg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
34583941 |
tgtttttgcataacttgactcaaagttacaccattttggacacatgattgggattttttatatctctggtcaagggg |
34583865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 116 - 172
Target Start/End: Complemental strand, 34578322 - 34578266
Alignment:
| Q |
116 |
tgtttttgcataacttgactcaaagttacaccattttggacacttgattgggatttt |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
34578322 |
tgtttttgcataacttgactcaaagttacacaattttggacacatgattgggatttt |
34578266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University