View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151_2D_low_95 (Length: 211)
Name: NF3151_2D_low_95
Description: NF3151_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151_2D_low_95 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 21 - 211
Target Start/End: Complemental strand, 10492161 - 10491971
Alignment:
| Q |
21 |
tacgtgacttgtttgtggggcagcaaaaagacatatttgactctctatacggttcagttattgatcgactaattaaggtctttgattttattttatttgt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| ||| |
|
|
| T |
10492161 |
tacgtgacttgtttgtggggcagcaaaaagacatatttgactctctatacggttcagttattgattgactaattaaggtctttgatttgattttatctgt |
10492062 |
T |
 |
| Q |
121 |
tgtccttagcaagaaaatctaatgtatttgttgaattttctctatagtagcttactaggtcagtatcaattagcagaagttaattgtctaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10492061 |
tgtccttagcaagaaaatctaatgtatttgttgaattttctctatagtagcttactaggtcagtgtcaattagcagaagttaattgtctaa |
10491971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University