View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3151_2D_low_99 (Length: 201)
Name: NF3151_2D_low_99
Description: NF3151_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3151_2D_low_99 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 2e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 18323634 - 18323777
Alignment:
| Q |
1 |
acaacacaaaaaccatggcttattttctactactagcatcaatgatagttgggattggaatgtcagattcatccaaagagaaacaagaatgcacagctca |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18323634 |
acaacacaaaagccatggcttattttctactactagcatcaatgatagttgggattggaatgtcagattcatccaaagagaaacaagaatgcacagctca |
18323733 |
T |
|
| Q |
101 |
attaacagggctagcatcatgccttccctatgttgttggtgaag |
144 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
18323734 |
attaacagggctagcatcgtgccttccctatgttgaaggtgaag |
18323777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 129 - 185
Target Start/End: Complemental strand, 18323530 - 18323474
Alignment:
| Q |
129 |
tatgttgttggtgaagaatgttatttatcatatcttgtataagcttttgtgtgatgt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18323530 |
tatgttgttggtgaagaatgttatttatcatatcttgtataagcttttgtgtaatgt |
18323474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University