View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3152_high_7 (Length: 272)
Name: NF3152_high_7
Description: NF3152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3152_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 124 - 255
Target Start/End: Complemental strand, 39316665 - 39316535
Alignment:
| Q |
124 |
tacgttgttatacaagtcattgtatgaatactattaaaataatgagattcatttcaccccacaaaatcactgaattttgtgtccctttcttttgtcaatc |
223 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
39316665 |
tacgttgttatacaaatcattgtatgaatactattaaa-taatgagattcatttcaccccacaaaataactgaattttgtgtccctttcttttatcaatc |
39316567 |
T |
 |
| Q |
224 |
ttaaatattttgagattacctagtataaaaat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39316566 |
ttaaatattttgagattacctagtataaaaat |
39316535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 18 - 129
Target Start/End: Complemental strand, 39318154 - 39318043
Alignment:
| Q |
18 |
attattaacatatatcagagtttgacatatggttagttacatataagttagttttagaggttacttgttttacaagtaaaccaaatagtcgaacttttta |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39318154 |
attattaagatatatcagagtttgacatatggttagttacatataagttagttttagaggttacttgttttacaagtaaaccaaatagtcgaacttttta |
39318055 |
T |
 |
| Q |
118 |
ttctaatacgtt |
129 |
Q |
| |
|
||||| |||||| |
|
|
| T |
39318054 |
ttctactacgtt |
39318043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 43 - 96
Target Start/End: Complemental strand, 2610789 - 2610736
Alignment:
| Q |
43 |
catatggttagttacatataagttagttttagaggttacttgttttacaagtaa |
96 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2610789 |
catatggttagttggttagaagttagttttagaggttacttgttttccaagtaa |
2610736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University