View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3152_low_14 (Length: 235)

Name: NF3152_low_14
Description: NF3152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3152_low_14
NF3152_low_14
[»] chr5 (1 HSPs)
chr5 (93-220)||(19419457-19419584)


Alignment Details
Target: chr5 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 93 - 220
Target Start/End: Complemental strand, 19419584 - 19419457
Alignment:
93 cgttcggcgcgaatatcgctactcttctccccggtcactccctcaccgtcacaactacttccgaccgtaaactctccatcaacaacgtaacggttaatcc 192  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19419584 cgttcggcgcgaatgtcgctactcttctccccggtcactccctcaccgtcacaactacttccgaccgtaaactctccatcaacaacgtaacggttaatcc 19419485  T
193 aacgccgttgctcgatgacggttatctc 220  Q
    ||||||||||||||||||||||||||||    
19419484 aacgccgttgctcgatgacggttatctc 19419457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University