View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3153_high_4 (Length: 281)
Name: NF3153_high_4
Description: NF3153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3153_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 151 - 267
Target Start/End: Original strand, 1402798 - 1402914
Alignment:
| Q |
151 |
gaggcatgtatttggggtgtgaattaaatttaacagcttacctatggacttggcgtgaagttttagtttaattgnnnnnnnggaatttcaacaaatgctt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
1402798 |
gaggcatgtatttggggtgtgaattaaatttaacagcttacctatggacttggcgttaagttttagtttaattgtttttttggaatttcaacaagtgctt |
1402897 |
T |
 |
| Q |
251 |
tgtattgtgcagtttat |
267 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1402898 |
tgtattgtgcagtttat |
1402914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University