View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3153_low_4 (Length: 281)

Name: NF3153_low_4
Description: NF3153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3153_low_4
NF3153_low_4
[»] chr5 (1 HSPs)
chr5 (151-267)||(1402798-1402914)


Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 151 - 267
Target Start/End: Original strand, 1402798 - 1402914
Alignment:
151 gaggcatgtatttggggtgtgaattaaatttaacagcttacctatggacttggcgtgaagttttagtttaattgnnnnnnnggaatttcaacaaatgctt 250  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||       ||||||||||||| |||||    
1402798 gaggcatgtatttggggtgtgaattaaatttaacagcttacctatggacttggcgttaagttttagtttaattgtttttttggaatttcaacaagtgctt 1402897  T
251 tgtattgtgcagtttat 267  Q
    |||||||||||||||||    
1402898 tgtattgtgcagtttat 1402914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University