View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3154_low_17 (Length: 271)
Name: NF3154_low_17
Description: NF3154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3154_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 191 - 239
Target Start/End: Original strand, 41534197 - 41534245
Alignment:
| Q |
191 |
tattagcgttatcttgagtgtggtgcgtagtattacctgtttgtctgtg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41534197 |
tattagcgttatcttgagtgtggtgcgtagtattacctgtttgtgtgtg |
41534245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University