View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3155_high_21 (Length: 300)
Name: NF3155_high_21
Description: NF3155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3155_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 40 - 271
Target Start/End: Original strand, 55696178 - 55696409
Alignment:
| Q |
40 |
caatagagagaatcttgatccaatgtttggttgctgctacaccacgtagtttcccaatttgcacaatgcatttaccttggaacgcaagaaaaccgatgct |
139 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
55696178 |
caatagagagaatcttgatcccgtgtttggttgctgctacaccacgtagtttcccaatttgaacaatgcatttaccttggaatgcaagaaaactgatgct |
55696277 |
T |
 |
| Q |
140 |
atcgccaaaccaaacgtatacataacacatttcagaaagtgttcgagaatgcgctgctagcacttcacaaacttaattgttgtgccacactcccgaggac |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
55696278 |
atcgccaaaccaaacgtatacataacacatttcagaaagtgttcgagaatgcgctgctagcacttcacaaacttaatggttgtgccacactcccgatgac |
55696377 |
T |
 |
| Q |
240 |
gaaccagcagctattaactagaatgtagatat |
271 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |
|
|
| T |
55696378 |
gaaccagcagctattaacttgaatgtagatat |
55696409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University