View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3155_high_23 (Length: 287)
Name: NF3155_high_23
Description: NF3155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3155_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 24 - 109
Target Start/End: Original strand, 2747269 - 2747354
Alignment:
| Q |
24 |
tgttgttagtttggtttgggtgaagtagtttgtgatgnnnnnnnnattgtgggactaggaaatgaagataaaatattgagggggtg |
109 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2747269 |
tgttgttggtttggtttgggtgaagtagtttgtgatgttttttttattgtgggactaggaaatgaagataaaatattgagggggtg |
2747354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 230 - 278
Target Start/End: Original strand, 2747486 - 2747534
Alignment:
| Q |
230 |
cgttgttgtgatcggaaaataaatccaaacaaagtatgtgtgatgatgt |
278 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2747486 |
cgttgctgtgatcggaaaataaatccaaacaaagtatgtgtgatgatgt |
2747534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University