View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3155_high_37 (Length: 229)
Name: NF3155_high_37
Description: NF3155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3155_high_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 213
Target Start/End: Original strand, 4189713 - 4189908
Alignment:
| Q |
18 |
tgaactgtttaccgttcggactacaccagtttggtatgatgaatgtactttaatttgtatttaacaatttttattgttttaaattttataatacaaatag |
117 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4189713 |
tgaactgtttttcattcggactacaccagtttggtatgatgaatgcactttaatttgtatttaacaatttttattgttttaaattttataatacaaatag |
4189812 |
T |
 |
| Q |
118 |
gaacaccataataatctgagaaattaattatgaccgtttattatgtctgcaatagtttatgaatttggaccaaattttaaccatggtccacataat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4189813 |
gaacaccataataatctgagaaattaattatgaccgtttattatgtctgcaatagtttatgaatttggaccaaattttaaccatggtccacataat |
4189908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University