View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3155_high_40 (Length: 213)
Name: NF3155_high_40
Description: NF3155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3155_high_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 1370572 - 1370383
Alignment:
| Q |
1 |
cctgccctagaagagacattagagcccaaaccacagcatcaggatgctccgatgactccgctaaaagaatcaagtcnnnnnnnnnnnnnnntatcacaat |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1370572 |
cctgccctagaagagacattagagtccaaaccacagcatcaagatgctccaatgactccgctaaaagaatcaagtcaaaaaagaaaaaa--tatcacaat |
1370475 |
T |
|
| Q |
101 |
caagaccaccataatctcaactcaagaatgcaatatattaacaagaaacaacttaccagttccaagaatttgcacaagaatgtccacaacat |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1370474 |
caagaccaccataatctcaactcaagaatgcaatatattaacaagaaacaacttaccagttccaagaatttgcacaaaaatgtccacaacat |
1370383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University