View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3155_low_23 (Length: 318)
Name: NF3155_low_23
Description: NF3155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3155_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 5e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 110 - 312
Target Start/End: Original strand, 12607985 - 12608187
Alignment:
| Q |
110 |
tagagtatggttttattaggctgttcagctttattgggtattttagtctacagagaagttttcactgcaaacatttagaggcttttgagttttgacgatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12607985 |
tagagtatggttttattaggctgttcagctttattgagtattttactctacagagaagttttcactgcaaacatttagaggcttttgagttttgacgatt |
12608084 |
T |
 |
| Q |
210 |
caacgatatacaattcaagtatctgagtttgagttgttggtgcacccttccttgcctgcattctagcttaccttccttcattcaccccaattcttacgcc |
309 |
Q |
| |
|
||| |||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12608085 |
caaggatatacaattcgagtatctgagtttgagttgttggtgcacccttccttggctgcattctagcttaccttccttcattcaccccaattcttacgcc |
12608184 |
T |
 |
| Q |
310 |
ttt |
312 |
Q |
| |
|
||| |
|
|
| T |
12608185 |
ttt |
12608187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 22 - 105
Target Start/End: Original strand, 12607649 - 12607732
Alignment:
| Q |
22 |
tggccaacacctctagcctgtcggacgtatttggccaaatagctacttgagttctatacgttcggcttgatcaattatggttgc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
12607649 |
tggccaacacctctagcctgtcggacgtatttggccaaatagctacttgagttctctacgttcgacttgatcaattatggttgc |
12607732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University