View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3155_low_29 (Length: 287)

Name: NF3155_low_29
Description: NF3155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3155_low_29
NF3155_low_29
[»] chr1 (2 HSPs)
chr1 (24-109)||(2747269-2747354)
chr1 (230-278)||(2747486-2747534)


Alignment Details
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 24 - 109
Target Start/End: Original strand, 2747269 - 2747354
Alignment:
24 tgttgttagtttggtttgggtgaagtagtttgtgatgnnnnnnnnattgtgggactaggaaatgaagataaaatattgagggggtg 109  Q
    ||||||| |||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||    
2747269 tgttgttggtttggtttgggtgaagtagtttgtgatgttttttttattgtgggactaggaaatgaagataaaatattgagggggtg 2747354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 230 - 278
Target Start/End: Original strand, 2747486 - 2747534
Alignment:
230 cgttgttgtgatcggaaaataaatccaaacaaagtatgtgtgatgatgt 278  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||    
2747486 cgttgctgtgatcggaaaataaatccaaacaaagtatgtgtgatgatgt 2747534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University