View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3155_low_30 (Length: 285)
Name: NF3155_low_30
Description: NF3155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3155_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 16800735 - 16800856
Alignment:
| Q |
1 |
ttgctagaaattcttactagctacaattaaaatctttgtctgatgactctcaaatatattgatgtgttgtgtttgtacctttaacttacttaattaaccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16800735 |
ttgctagaaattcttactagctacaattaaaatctttgtctgatgactctcaaatatattgatgtgttgtgtttgtacctttaacttacttaattaaccg |
16800834 |
T |
 |
| Q |
101 |
ttcaaacattactaactaaatg |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
16800835 |
ttcaaacattactaactaaatg |
16800856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 177 - 266
Target Start/End: Original strand, 16800909 - 16800995
Alignment:
| Q |
177 |
ccagataaataaaggtcactaattaaccaaaagataaataatagtgttgtatgctggattgttg-cttaatgctaggaataatgcacctat |
266 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
16800909 |
ccagataaataaaggtcactaa----ccaaaagataaataatagtgttgtatgctgaattgttgtcttaatgttaggaataatgcacctat |
16800995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University