View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3155_low_31 (Length: 271)
Name: NF3155_low_31
Description: NF3155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3155_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 74 - 256
Target Start/End: Complemental strand, 48967381 - 48967199
Alignment:
| Q |
74 |
ccaacacaattggagaaattgagtggcttaattgatttgaattaaggattagagaataaaaggacctggtctcaaatcttcaaattattagaaaagaatg |
173 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48967381 |
ccaacacaattggagaaattgagtagtttaattgatttgaactaaggattagagaataaaaggacctggtctcaaatcttcaaattattagaaaagaatg |
48967282 |
T |
 |
| Q |
174 |
atcggtgaacgcattatgattcatggtataattacaacaacaattgtgttgcgttcaccgatcatacaaaaattgtgtatact |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48967281 |
atcggtgaacgcattatgattcatggtataattacaacaacaattgtgttgcgttcaccgatcatacaaaaattgtgtatact |
48967199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 13 - 76
Target Start/End: Complemental strand, 48967883 - 48967820
Alignment:
| Q |
13 |
aatattcaacacttaaggctaagagactaaaggattgggcttaggtttctacctagcgtgtcca |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
48967883 |
aatattcaacacttaaggctaagagactaaaggattgggcttaggtttctatctagcatgtcca |
48967820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University