View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3155_low_35 (Length: 257)

Name: NF3155_low_35
Description: NF3155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3155_low_35
NF3155_low_35
[»] chr7 (1 HSPs)
chr7 (1-239)||(39261940-39262177)


Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 39262177 - 39261940
Alignment:
1 tcatacctaaatggtgaaggcaaaatacgcttcaattaactgagtgacttaatacttgataccaaacacaagctatatttaatnnnnnnnnnttattatg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||    
39262177 tcatacctaaatggtgaaggcaaaatacgcttcaattaactgagtgacttaatacttgataccaaacacaagctatatttaataaaaaaaa-ttattatg 39262079  T
101 tataacaaaagtaaatgttcgataattcccctgaacaataatgtataatacattagtacaaagaacgattatcatttcttaatatggaaaattcatttgt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
39262078 tataacaaaagtaaatgttcgataattcccctgaacaataatgtataatacattagtacaaagaacgattatcatttcttaatatggaaaattcatgtgt 39261979  T
201 ttattttagggtatgaaatgattgaaaggatggcatact 239  Q
    |||||||||||||||||||||||||||||||||||||||    
39261978 ttattttagggtatgaaatgattgaaaggatggcatact 39261940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University