View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3157_high_6 (Length: 345)
Name: NF3157_high_6
Description: NF3157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3157_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 1 - 338
Target Start/End: Original strand, 37373914 - 37374252
Alignment:
| Q |
1 |
ccttctactcaaagctacatccaccgtagtcacttgaccttctcctggtggccattatctttatatttctgatgctaagctacctgaaaccccaatcttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37373914 |
ccttctactcaaagctacatccaccgtagtcacttgaccttctcctggtggccattatctttatatttctgatgctaagctacctgaaaccccaatcttg |
37374013 |
T |
|
| Q |
101 |
cttctagaacgcccttataccaaaatccttagcttttcaattctgttggacgaatgaacctttatctcgcacaattgtgcatgcagtcttcgtaaagttt |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37374014 |
cttctagagcgcccttataccaaaatccttagcttttcaattctgttggacgaatgaacctttatctcgcacaattgtgcatgcagtcttcgtaaagttt |
37374113 |
T |
|
| Q |
201 |
tttcaggaagtctaattgtccatgtgttgcttgtatcagtgcttcttcctttccaaaatattcagtgaatgacaataataattctcgcattcttgcaaaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37374114 |
tttcaggaagtctaattgtccatgtgttgcctgtatcagtgcctcttcctttccaaaatattcagtgaatgacaataataattctcgcattcttgcaaaa |
37374213 |
T |
|
| Q |
301 |
acttgtatgattatcaagatggtg-tgatgatgatgatg |
338 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37374214 |
acttgtatgattatcaagatggtgatgatgatgatgatg |
37374252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University