View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3157_low_12 (Length: 229)
Name: NF3157_low_12
Description: NF3157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3157_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 36679664 - 36679448
Alignment:
| Q |
1 |
acttacctctttgtacattttttggtggtcctcaacctttcttttttgacattattaacgaaacctatagtacgtatgaactatatatcgtccttacgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36679664 |
acttacctctttgtacattttttggtggtcctcaacctttcttttttgatattattaacgaaacctatagtacgtatgaactatatatcgtccttacgaa |
36679565 |
T |
|
| Q |
101 |
gtacaaatc----atacagcttgcaagataagagactgttaaaatgtttaacatgtacnnnnnnngtttgaatttccgtagatttgtctcactgtttata |
196 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36679564 |
gtacaaatcatatatacagcttgcaagataagagactgttaaaatgtttaacatgtactttttttgtttgaatttccgtagatttgtctcactgtttata |
36679465 |
T |
|
| Q |
197 |
gcaatacgtagtgataa |
213 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
36679464 |
gcaatacgtagtgataa |
36679448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University